Quick Order

Text Size:AAA

Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
EBOV EBOV-G cDNA Clone Product Information
Gene_bank_ref_id:U23187.1
RefSeq ORF Size:2028bp
cDNA Description:Full length Clone DNA of Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein with C terminal HA tag.
Gene Synonym:EBOV-G
Species:EBOV
Vector:pCMV3-C-HA
Plasmid:pCMV3-ZaireEBOV-U23187-GP-HA
Restriction Site:KpnI + XbaI (6kb + 2.08kb)
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein ORF mammalian expression plasmid, C-HA tag on other vectors
Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein ORF mammalian expression plasmid, C-GFPSpark tagVG40304-ACG$345
Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40304-ACR$345
Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein ORF mammalian expression plasmid, N-GFPSpark tagVG40304-ANG$345
Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40304-ANR$315
Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein ORF mammalian expression plasmid, C-Flag tagVG40304-CF$315
Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein ORF mammalian expression plasmid, C-His tagVG40304-CH$315
Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein ORF mammalian expression plasmid, C-Myc tagVG40304-CM$315
Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein ORF mammalian expression plasmid, C-HA tagVG40304-CY$315
Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein ORF mammalian expression plasmid (Codon Optimized)VG40304-G$195
Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein ORF mammalian expression plasmid, N-Flag tagVG40304-NF$315
Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein ORF mammalian expression plasmid, N-His tagVG40304-NH$315
Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein (Codon Optimized) ORF mammalian expression plasmid, N-Myc tagVG40304-NM$315
Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein ORF mammalian expression plasmid, N-HA tagVG40304-NY$315
Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein natural ORF mammalian expression plasmidVG40304-UT$315
 Learn more about expression Vectors
Product nameProduct name
Background

The fourth gene of the EBOV genome encodes a 160-kDa envelope-attached glycoprotein (GP) and a 110 kDa secreted glycoprotein (sGP). Both GP and sGP have an identical 295-residue N-terminus, however, they have different C-terminal sequences. Recently, great attention has been paid to GP for vaccines design and entry inhibitors isolation. GP is a class I fusion protein which assembles as trimers on viral surface and plays an important role in virus entry and attachment. Mature GP is a disulfide-linked heterodimer formed by two subunits, GP1 and GP2, which are generated from the proteolytical process of GP precursor (pre-GP) by cellular furin during virus assembly . The GP1 subunit contains a mucin domain and a receptor-binding domain (RBD); the GP2 subunit has a fusion peptide, a helical heptad-repeat (HR) region, a transmembrane (TM) domain, and a 4-residue cytoplasmic tail. The RBD of GP1 mediates the interaction of EBOV with cellular receptor (e.g. DC-SIGN/LSIGN, TIM-1, hMGL, NPC1, β-integrins, folate receptor-α, and Tyro3 family receptors), of which TIM1 and NPC1 are essential for EBOV entry; the mucin domain having N- and O-linked glycans enhances the viral attachment to cellular hMGL, and participates in shielding key neutralization epitopes, which helps the virus evades immune elimination. There are large conformation changes of GP2 during membrane fusion, which enhance the insertion of fusion loop into cellular membrane and facilitate the release of viral nucleocapsid core to cytoplasm.

References
  1. Volchkov VE, et al. Processing of the Ebola virus glycoprotein by the proprotein convertase furin. Proc Natl Acad Sci U S A. 1998 May 12;95(10):5762-7.
  2. Lee JE, et al. Structure of the Ebola virus glycoprotein bound to an antibody from a human survivor. Nature. 2008 Jul 10;454(7201):177-82. doi: 10.1038/nature07082.
  3. Hood CL, et al. Biochemical and structural characterization of cathepsin L-processed Ebola virus glycoprotein: implications for viral entry and immunogenicity. J Virol. 2010 Mar;84(6):2972-82. doi: 10.1128/JVI.02151-09.
  4. Cook JD and Lee JE. The secret life of viral entry glycoproteins: moonlighting in immune evasion. PLoS Pathog. 2013 May;9(5):e1003258. doi: 10.1371/journal.ppat.1003258.
  5. Miller EH and Chandran K. Filovirus entry into cells - new insights. Curr Opin Virol. 2012 Apr;2(2):206-14. doi: 10.1016/j.coviro.2012.02.015.
Size / Price
Catalog: VG40304-CY
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"