After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Dengue virus DENV-2 (strain New Guinea C) NS2A ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
DENV DENV-NS2A cDNA Clone Product Information
NCBI RefSeq:AF038403.1
RefSeq ORF Size:654bp
cDNA Description:Full length Clone DNA of DENV-2 (strain New Guinea C) NS2A with N terminal His tag.
Gene Synonym:DENV-NS2A
Species:DENV
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence AF038403.1 (3478..4131), corresponding to amino acid sequence AAC59275.1 (aa 1128-1345).
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Dengue virus DENV-2 (strain New Guinea C) NS2A ORF mammalian expression plasmid, N-His tag on other vectors
Dengue virus DENV-2 (strain New Guinea C) NS2A ORF mammalian expression plasmid, C-GFPSpark tagVG40264-ACG$325
Dengue virus DENV-2 (strain New Guinea C) NS2A ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40264-ACR$325
Dengue virus DENV-2 (strain New Guinea C) NS2A ORF mammalian expression plasmid, N-GFPSpark tagVG40264-ANG$325
Dengue virus DENV-2 (strain New Guinea C) NS2A ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40264-ANR$325
Dengue virus DENV-2 (strain New Guinea C) NS2A ORF mammalian expression plasmid, C-Flag tagVG40264-CF$295
Dengue virus DENV-2 (strain New Guinea C) NS2A ORF mammalian expression plasmid, C-His tagVG40264-CH$295
Dengue virus DENV-2 (strain New Guinea C) NS2A ORF mammalian expression plasmid, C-Myc tagVG40264-CM$295
Dengue virus DENV-2 (strain New Guinea C) NS2A ORF mammalian expression plasmid, C-HA tagVG40264-CY$295
登革病毒II型 DENV-2 (strain New Guinea C) NS2A 基因全长ORF克隆VG40264-G$95
Dengue virus DENV-2 (strain New Guinea C) NS2A ORF mammalian expression plasmid, N-Flag tagVG40264-NF$295
Dengue virus DENV-2 (strain New Guinea C) NS2A ORF mammalian expression plasmid, N-His tagVG40264-NH$295
Dengue virus DENV-2 (strain New Guinea C) NS2A ORF mammalian expression plasmid, N-Myc tagVG40264-NM$295
Dengue virus DENV-2 (strain New Guinea C) NS2A ORF mammalian expression plasmid, N-HA tagVG40264-NY$295
Dengue virus DENV-2 (strain New Guinea C) NS2A natural ORF mammalian expression plasmidVG40264-UT$295
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40264-NH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"