After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NAcDNA Clone Product Information
Gene_bank_ref_id:JQ924787.1
cDNA Size:1413
cDNA Description:ORF Clone of Influenza A H10N8 (A/duck/Guangdong/E1/2012) NA DNA.
Gene Synonym:NA
Species:H10N8
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
 
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedVG40203-ACG$325
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone / ORF Clone (full-length ORF Clone), expression ready, C-OFPSpark tagVG40203-ACR$325
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedVG40203-ANG$325
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone / ORF Clone (full-length ORF Clone), expression ready, N-OFPSpark tagVG40203-ANR$325
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40203-CF$295
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedVG40203-CH$295
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedVG40203-CM$295
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedVG40203-CY$295
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone / ORF Clone (full-length ORF Clone)VG40203-G$95
Influenza B (B/Brisbane/60/2008) Neuraminidase / NA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untaggedVG40203-G-N$295
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedVG40203-NF$295
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedVG40203-NH$295
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedVG40203-NM$295
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedVG40203-NY$295
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedVG40203-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type of neuraminidase found on the surface of influenza viruses that enables the virus to be released from the host cell.

Influenza neuraminidase is composed of four identical subunits arranged in a square. It is normally attached to the virus surface through a long protein stalk. The active sites are in a deep depression on the upper surface. They bind to polysaccharide chains and clip off the sugars at the end. The surface of neuraminidase is decorated with several polysaccharide chains that are similar to the polysaccharide chains that decorate our own cell surface proteins.

Neuraminidase (NA) and hemagglutinin (HA) are major membrane glycoproteins found on the surface of influenza virus. Hemagglutinin binds to the sialic acid-containing receptors on the surface of host cells during initial infection and at the end of an infectious cycle. Neuraminidase, on the other hand, cleaves the HA-sialic acid bondage from the newly formed virions and the host cell receptors during budding. Neuraminidase thus is described as a receptor-destroying enzyme which facilitates virus release and efficient spread of the progeny virus from cell to cell.

Influenza antibody and influenza antibodies are very important research tools for influenza diagnosis, influenza vaccine development, and anti-influenza virus therapy development. Monoclonal or polyclonal antibody can be raised with protein based antigen or peptide based antigen. Antibody raised with protein based antigen could have better specificity and/or binding affinity than antibody raised with peptide based antigen, but cost associated with the recombinant protein antigen is usually higher. Anti influenza virus hemagglutinin (HA) monoclonal antibody or polyclonal antibody can be used for ELISA assay, western blotting detection, Immunohistochemistry (IHC), flow cytometry, neutralization assay, hemagglutinin inhibition assay, and early diagnosis of influenza viral infection.

Sino Biological has developed state-of-the-art monoclonal antibody development technology platforms: mouse monoclonal antibody and rabbit monoclonal antibody. Our rabbit monoclonal antibody platform is one of a kind and offers some unique advantages over mouse monoclonal antibodies, such as high affinity, low cross-reactivity with rabbit polyclonal antibodies.

Size / Price
Catalog:VG40203-NH
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"