Quick Order

Influenza A H3N2 (A/Hong Kong/1/1968) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H3N2 HA cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:1701bp
cDNA Description:Full length Clone DNA of Influenza A virus H3N2 (A/Hong Kong/1/1968) Hemagglutinin with N terminal His tag.
Gene Synonym:HA
Species:H3N2
Vector:pCMV3-SP-N-His
Plasmid:pCMV3-His-H3N2-HK-68-HA
Restriction Site:KpnI + XbaI (6kb + 1.79kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with Q91MA7.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
H3N2 HA Gene Plasmid Map
Influenza A H3N2 (A/Hong Kong/1/1968) Hemagglutinin (Codon Optimized) natural ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Influenza A H3N2 (A/Hong Kong/1/1968) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tag on other vectors
Influenza A H3N2 (A/Hong Kong/1/1968) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40116-ACG$345
Influenza A H3N2 (A/Hong Kong/1/1968) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40116-ACR$345
Influenza A H3N2 (A/Hong Kong/1/1968) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG40116-C$395
Influenza A H3N2 (A/Hong Kong/1/1968) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG40116-CF$315
Influenza A H3N2 (A/Hong Kong/1/1968) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG40116-CH$315
Influenza A H3N2 (A/Hong Kong/1/1968) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG40116-CM$315
Influenza A H3N2 (A/Hong Kong/1/1968) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG40116-CY$315
Influenza A H3N2 (A/Hong Kong/1/1968) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG40116-NF$315
Influenza A H3N2 (A/Hong Kong/1/1968) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG40116-NH$315
Influenza A H3N2 (A/Hong Kong/1/1968) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40116-NM$315
Influenza A H3N2 (A/Hong Kong/1/1968) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG40116-NY$315
Influenza A H3N2 (A/Hong Kong/1/1968) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG40116-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40116-NH
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"