Quick Order

Text Size:AAA

Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HAcDNA Clone Product Information
cDNA Size:1704
cDNA Description:ORF Clone of Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin DNA. This cDNA clone has gone through customized codon optimization in order to obtain high level of protein expression in particular cell lines. Therefore, although the translated amino acid sequence is identical to the amino sequence on Gene Bank, the DNA sequence is different from that on Gene Bank.
Gene Synonym:Hemagglutinin, HA
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-His-tagged on other vectors
Influenza A H5N1 (A/chicken/Yamaguchi/7/2004) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-GFPSpark-tagged, expression readyVG40088-ACG$345
Influenza A H5N1 (A/chicken/Yamaguchi/7/2004) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, expression ready, C-OFPSpark tagVG40088-ACR$345
Influenza A H5N1 (A/chicken/Yamaguchi/7/2004) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression readyVG40088-C$395
Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-FLAG-taggedVG40088-CF$315
Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-His-taggedVG40088-CH$315
Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-Myc-taggedVG40088-CM$315
Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-HA-taggedVG40088-CY$315
Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-FLAG-taggedVG40088-NF$315
Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-His-taggedVG40088-NH$315
Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-Myc-taggedVG40088-NM$315
Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-HA-taggedVG40088-NY$315
Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untaggedVG40088-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name