Quick Order

Rat TPM4 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat TPM4 cDNA Clone Product Information
Gene_bank_ref_id:NM_012678.2
RefSeq ORF Size:747bp
cDNA Description:Full length Clone DNA of Rattus norvegicus tropomyosin 4 with N terminal His tag.
Gene Synonym:Tpm4
Species:Rat
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

TPM4, also known as tropomyosin 4, is a member of the tropomyosin family. Members of this family are actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. TPM4 is expressed in cardiac tissue and platelets. It is highly expressed in the platelets of hypertensive patients. TPM4 plays a central role, in association with the troponin complex, in the calcium dependent regulation of vertebrate striated muscle contraction. Smooth muscle contraction is regulated by interaction with caldesmon. In non-muscle cells it is implicated in stabilizing cytoskeleton actin filaments.

References
  • Udeshi ND. et al., 2012, Mol Cell Proteomics. 11 (5): 148-59.
  • Rostila A. et al., 2012, Lung Cancer. 77 (2): 450-9.
  • Vlahovich N. et al., 2008, Cell Motil Cytoskeleton. 65 (1): 73-85.
  • Size / Price
    Catalog: RG81616-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"