Quick Order

Rat TPM4 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat TPM4 cDNA Clone Product Information
Gene_bank_ref_id:NM_012678.2
RefSeq ORF Size:747bp
cDNA Description:Full length Clone DNA of Rattus norvegicus tropomyosin 4 with C terminal HA tag.
Gene Synonym:Tpm4
Species:Rat
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

TPM4, also known as tropomyosin 4, is a member of the tropomyosin family. Members of this family are actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. TPM4 is expressed in cardiac tissue and platelets. It is highly expressed in the platelets of hypertensive patients. TPM4 plays a central role, in association with the troponin complex, in the calcium dependent regulation of vertebrate striated muscle contraction. Smooth muscle contraction is regulated by interaction with caldesmon. In non-muscle cells it is implicated in stabilizing cytoskeleton actin filaments.

References
  • Udeshi ND. et al., 2012, Mol Cell Proteomics. 11 (5): 148-59.
  • Rostila A. et al., 2012, Lung Cancer. 77 (2): 450-9.
  • Vlahovich N. et al., 2008, Cell Motil Cytoskeleton. 65 (1): 73-85.
  • Size / Price
    Catalog: RG81616-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"