After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat IZUMO4 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat IZUMO4 cDNA Clone Product Information
NCBI RefSeq:XM_002726872.3
RefSeq ORF Size:684bp
cDNA Description:Full length Clone DNA of Rattus norvegicus IZUMO family member 4 with C terminal HA tag.
Gene Synonym:RGD1564722
Species:Rat
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Izumo is a sperm membrane protein which plays a key role in the fusion in the mouse. It has an Immunoglobulin (Ig) domain and an N-terminal domain for which neither the functions nor homologous sequences are known. Up to now, there four members has an N-terminal domain with significant homology to the N-terminal domain of Izumo. We call this domain Izumo domain. The four proteins are Izumo 1, 2, 3, and 4. Izumo domain possesses the ability to form dimers, whereas the transmembrane domain or the cytoplasmic domain or both of Izumo 1 are required for the formation of multimers of higher order. Izumo 1-3 are transmembrane proteins expressed specifically in the testis, and Izumo 4 is a soluble protein expressed in the testis and in other tissues. Izumo 1, 3, and 4 formed protein complexes on sperm, Izumo 1 forming several larger complexes and Izumo 3 and 4 forming a single larger complex. Co-immunoprecipitation studies showed the presence of other sperm proteins associated with Izumo 1, suggesting Izumo 1 forms a multiprotein membrane complex.

References
  • Gerhard DS, et al. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14(10B):2121-7.
  • Lamesch P, et al. (2007) hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. Genomics. 89(3):307-15.
  • Ellerman DA, et al. (2009) Izumo is part of a multiprotein family whose members form large complexes on mammalian sperm. Mol Reprod Dev. 76(12):1188-99.
  • Size / Price
    Catalog: RG81606-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"