After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rabbit S100B ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rabbit S100B cDNA Clone Product Information
Gene_bank_ref_id:NM_001082730.1
RefSeq ORF Size:279bp
cDNA Description:Full length Clone DNA of Rabbit S100 calcium binding protein B with N terminal HA tag.
Gene Synonym:S100B
Species:Rabbit
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

S100B is a member of the S100 family of proteins containing two EF-hand-type calcium-binding motifs. S100B exerts both intracellular and extracellular functions. Intracellular S100B acts as a stimulator of cell proliferation and migration and an inhibitor of apoptosis and differentiation, which might have important implications during brain, cartilage and skeletal muscle development and repair, activation of astrocytes in the course of brain damage and neurodegenerative processes, and of cardiomyocyte remodeling after infarction, as well as in melanomagenesis and gliomagenesis. As an extracellular factor, S100B engages RAGE (receptor for advanced glycation end products) in a variety of cell types with different outcomes (i.e. beneficial or detrimental, pro-proliferative or pro-differentiative) depending on the concentration attained by the protein, the cell type and the microenvironment. This calcium binding astrocyte-specific cytokine, presents a marker of astrocytic activation and reflects CNS injury. The excellent sensitivity of S100B has enabled it to confirm the existence of subtle brain injury in patients with mild head trauma, strokes, and after successful resuscitation from cardiopulmonary arrest. Recent findings provide evidence, that S100B may decrease neuronal injury and/or contribute to repair following traumatic brain injury (TBI). Hence, S100B, far from being a negative determinant of outcome, as suggested previously in the human TBI and ischemia literature, is of potential therapeutic value that could improve outcome in patients who sustain various forms of acute brain damage.

References
  • Kleindienst A, et al. (2006) A critical analysis of the role of the neurotrophic protein S100B in acute brain injury. J Neurotrauma. 23(8): 1185-200.
  • Bloomfield SM, et al. (2007) Reliability of S100B in predicting severity of central nervous system injury. Neurocrit Care. 6(2): 121-38.
  • Donato R, et al. (2009) S100B's double life: intracellular regulator and extracellular signal. Biochim Biophys Acta. 1793(6): 1008-22.
  • Beaudeux JL. (2009) S100B protein: a novel biomarker for the diagnosis of head injury. Ann Pharm Fr. Beaudeux JL. 67(3): 187-94.
  • Size / Price
    Catalog: TG65082-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"