Quick Order

Rat PTGDS ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat PTGDS cDNA Clone Product Information
Gene_bank_ref_id:NM_013015.2
RefSeq ORF Size:570bp
cDNA Description:Full length Clone DNA of Rattus norvegicus prostaglandin D2 synthase (brain) with C terminal HA tag.
Gene Synonym:PH2DISO
Species:Rat
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

PTGDS, also known as L-PGDS, belongs to the calycin superfamily,lipocalin family. Lipocalins share limited regions of sequence homology and a common tertiary structure architecture. They transport small hydrophobic molecules such as steroids, bilins, retinoids, and lipids. PTGDS is a glutathione-independent prostaglandin D synthase that catalyzes the conversion of PGH2 to PGD2. It is involved in smooth muscle contraction/relaxation and a variety of central nervous system functions. PTGDS may have an anti-apoptotic role in oligodendrocytes. It binds small non-substrate lipophilic molecules, including biliverdin, bilirubin, retinal, retinoic acid and thyroid hormone, and may act as a scavenger for harmful hydrophopic molecules and as a secretory retinoid and thyroid hormone transporter. It is likely to play important roles in both maturation and maintenance of the central nervous system and male reproductive system.

References
  • Aebersold R, et al. (1993) Identification of a brain-specific human cerebrospinal fluid glycoprotein, beta-trace protein. Theor Electrophor. 3:229-234.
  • Oliver K, et al. (2004) DNA sequence and analysis of human chromosome 9. Nature. 429:369-374.
  • Bonaldo MF, et al. (1997) Normalization and subtraction: two approaches to facilitate gene discovery. Genome Res. 6(9):791-806.
  • Size / Price
    Catalog: RG81340-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"