Quick Order

Rat ADSL ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat ADSL cDNA Clone Product Information
Gene_bank_ref_id:NM_001130503.1
RefSeq ORF Size:1455bp
cDNA Description:Full length Clone DNA of Rattus norvegicus adenylosuccinate lyase with C terminal HA tag.
Gene Synonym:null
Species:Rat
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Adenylosuccinate lyase, also known as adenylosuccinase, ADSL or ASL, is an enzyme implicated in the reaction of adenylosuccinat converting to AMP and fumarate as part of the purine nucleotide cycle. The two substates of adenylosuccinate lyase (ADSL) are dephosphorylated derivatives of SAICA ribotide (SAICAR) and adenylosuccinate (S-AMP), which catalyzes an important reaction in the de novo pathway of purine biosynthesis. ADSL catalyzes two distinct reactions in the synthesis of purine nucleotides, both of which involve the _-elimination of fumarate to produce either aminoimidazole carboxamide ribotide from SAICAR or AMP from S-AMP. The Adenylosuccinate lyase deficiency is a rare autosomal recessive metabolic disorder characterized by the present of SAICA riboside and succinyladenosine (S-Ado). ADSL defect in different patients is often caused by different mutations to the enzyme.

References
  • Nassogne M, et al. (2000) Adenylosuccinase deficiency: an unusual cause of early-onset epilepsy associated with acquired microcephaly. Brain and development. 22 (6): 383-6.
  • Sivendran S, et al. (2004) Two novel mutant human adenylosuccinate lyases (ASLs) associated with autism and characterization of the equivalent mutant Bacillus subtilis ASL. J Biol Chem. 279 (51): 53789-97.
  • Lee TT, et al. (1999) His68 and His141 are critical contributors to the intersubunit catalytic site of adenylosuccinate lyase of Bacillus subtilis. Biochemistry. 38 (1): 22-32.
  • Size / Price
    Catalog: RG81324-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"