After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rat ARG1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ARG1cDNA Clone Product Information
Gene_bank_ref_id:NM_017134.3
cDNA Size:972
cDNA Description:ORF Clone of Rattus norvegicus arginase 1 DNA.
Gene Synonym:Arg1
Species:Rat
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

Arginase is the focal enzyme of the urea cycle hydrolysing L-arginine to urea and L-ornithine. Emerging studies have identified arginase in the vasculature and have implicated this enzyme in the regulation of nitric oxide (NO) synthesis and the development of vascular disease. Arginase also redirects the metabolism of L-arginine to L-ornithine and the formation of polyamines and L-proline, which are essential for smooth muscle cell growth and collagen synthesis. Arginase is encoded by two recently discovered genes (Arginase I and Arginase II). In most mammals, Arginase 1 (ARG1) also known as Arginase, liver, which functions in the urea cycle, and is located primarily in the cytoplasm of the liver. The second isozyme, Arginase II, has been implicated in the regulation of the arginine/ornithine concentrations in the cell. It is located in mitochondria of several tissues in the body, with most abundance in the kidney and prostate. It may be found at lower levels in macrophages, lactating mammary glands, and brain.

References
  • Durante W, et al. (2007) Arginase: a critical regulator of nitric oxide synthesis and vascular function. Clin Exp Pharmacol Physiol. 34(9): 906-11.
  • Waddington SN. (2002) Arginase in glomerulonephritis. Kidney Int. 61(3): 876-81.
  • Morris SM. (2002). Regulation of enzymes of the urea cycle and arginine metabolism. Annual review of nutrition. 22 (1): 87-105.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"