After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat COMMD9 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat COMMD9 cDNA Clone Product Information
Gene_bank_ref_id:NM_001033692.1
RefSeq ORF Size:597bp
cDNA Description:Full length Clone DNA of Rattus norvegicus COMM domain containing 9 with C terminal HA tag.
Gene Synonym:Commd9
Species:Rat
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

COMMD9 is a COMM domain-containing or COMMD protein. COMMD family is comprised of ten members which are widely conserved throughout evolution and share certain functional properties. They represent a recently discovered set of evolutionarily conserved factors characterized by the presence of a defining carboxy-terminal motif. COMMD protein functions in the control of the transcription factor NFkappaB. NFkappaB plays a critical role in a number of homeostatic processes in multicellular organisms, including the regulation of immunity and cell survival. COMMD proteins inhibit NFkappaB mediated gene expression, and recent mechanistic studies have revealed that COMMD1 controls the ubiquitination of NFkappaB subunits, an event linked to transcriptional termination. COMMD1 binds to a multimeric ubiquitin ligase containing Elongins B/C, Cul2 and SOCS1 (ECS( SOCS1)). In this complex, COMMD1 facilitates the binding of NFkappaB subunits to the ligase, thereby promoting their ubiquitination and degradation. Additional insights gained from these studies indicate that COMMD proteins likely play a broader role in cellular homeostasis through their participation in the ubiquitination pathway.

References
  • Ota T. et al., 2004, Nat Genet. 36 (1): 40-5.
  • Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Burstein E. et al., 2005, J Biol Chem. 280 (23): 22222-32.
  • Size / Price
    Catalog: RG81303-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"