After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rabbit ENO2 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rabbit ENO2 cDNA Clone Product Information
Gene_bank_ref_id:XM_002712914.1
RefSeq ORF Size:1305bp
cDNA Description:Full length Clone DNA of Rabbit enolase 2 (gamma, neuronal) with N terminal HA tag.
Gene Synonym:ENO2
Species:Rabbit
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
References
  • Pechumer H, et al. (1994) Detection of neuron-specific gamma-enolase messenger ribonucleic acid in normal human leukocytes by polymerase chain reaction amplification with nested primers. Lab Invest. 69 (6): 743-9.
  • Craig SP, et al. (1991) Localisation of neurone-specific enolase (ENO2) to 12p13. Cytogenet Cell Genet. 54 (1-2): 71-3.
  • Muley T, et al. (2003) Technical performance and diagnostic utility of the new Elecsys neuron-specific enolase enzyme immunoassay. Clin Chem Lab Med. 41 (1): 95-103.
  • Size / Price
    Catalog: TG65031-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"