Quick Order

Text Size:AAA

Rabbit GOT1 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rabbit GOT1 cDNA Clone Product Information
Gene_bank_ref_id:XM_002718630.1
RefSeq ORF Size:1242bp
cDNA Description:Full length Clone DNA of Rabbit glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1) with N terminal HA tag.
Gene Synonym:GOT1
Species:Rabbit
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Aspartate aminotransferase is a pyridoxal phosphate-dependent enzyme which exists in cytoplasmic and mitochondrial forms, aspartate aminotransferase and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and tricarboxylic acid cycles. The two enzymes are homodimeric and show close homology. There is a rare in-frame deletion in aspartate aminotransferase gene, which inactivates cytosolic aspartate aminotransferase(cAST) enzyme in the Old Order Amish. This may help to understand structure and function of the enzyme and would be useful for predicting serum aspartate AST levels.

References
  • Shen H, et al. (2011) Genome-wide association study identifies genetic variants in GOT1 determining serum aspartate aminotransferase levels. J Hum Genet. 56(11):801-5.
  • Doonan S, et al. (1985) Structural and genetic relationships between cytosolic and mitochondrial isoenzymes. Int J Biochem. 16(12):1193-9.
  • Panteghini M. (1990) Aspartate aminotransferase isoenzymes. Clin Biochem. 23(4):311-9.
  • Bousquet-Lemercier B, et al. (1990) Properties of human liver cytosolic aspartate aminotransferase mRNAs generated by alternative polyadenylation site selection. Biochemistry. 29(22):5293-9.
  • Size / Price
    Catalog: TG65026-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"