Quick Order

Rat SULT1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SULT1A1cDNA Clone Product Information
Gene_bank_ref_id:NM_031834.1
cDNA Size:876
cDNA Description:ORF Clone of Rattus norvegicus sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 DNA.
Gene Synonym:Stm, Stp1, ASTIV, Mx-ST, PST-1, St1a1, Sult1a3
Species:Rat
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
 
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

Sulfate conjugation catalyzed by cytosolic sulfotransferase (SULT) enzymes. The SULTs are Phase II drug-metabolizing enzymes that catalyze the addition of a sulfuryl moiety to both endogenous compounds, including steroids and neurotransmitters, and certain xenobiotics, including N-hydroxy-2-acetylaminoflourine and phenolic compounds, like alpha-naphthol. SULTs may be involved in the individual genetic disposition, species differences, and organotropisms for toxicological effects of chemicals. Particularly SULT1A1 (Sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1), a member of the sulfotransferase 1 subfamily, which is a major pathway for drug metabolism in humans. Humans have at least 10 functional SULT genes. There has been an explosion in information on sulfotransferase polymorphisms and their functional consequences. An Arg213His polymorphism in SULT1A1 has a strong influence on the level of enzyme protein and activity in platelets, which have been widely used for phenotyping. Statistically significant associations were observed between the SULT1A1 genotype (Arg213His) and age, obesity and certain neoplasias (mammary, pulmonary, esophageal and urothelial cancer). Furthermore, the polymorphism of the SULT1A1 may be closely associated with breast cancer.

References
  • Coughtrie MW. 2002. Sulfation through the looking glass--recent advances in sulfotransferase research for the curious. Pharmacogenomics J. 2(5): 297-308.
  • Klaassen CD, et al. (1998) Regulation of sulfotransferase mRNA expression in male and female rats of various ages. Chem Biol Interact. 109(1-3): 299-313.
  • Glatt H. (2000) Sulfotransferases in the bioactivation of xenobiotics. Chem Biol Interact. 129(1-2): 141-70.
  • Glatt H, et al. (2004) Pharmacogenetics of soluble sulfotransferases (SULTs). Naunyn Schmiedebergs Arch Pharmacol. 369(1): 55-68.
  • Hebbring SJ, et al. (2008) Sulfotransferase gene copy number variation: pharmacogenetics and function. Cytogenet Genome Res. 123(1-4): 205-10.
  • Size / Price
    Catalog:RG81238-NH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"