After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rat CRIP2 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat CRIP2 cDNA Clone Product Information
Gene_bank_ref_id:NM_022501.1
RefSeq ORF Size:627bp
cDNA Description:Full length Clone DNA of Rattus norvegicus cysteine-rich protein 2 with N terminal His tag.
Gene Synonym:CRP2
Species:Rat
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

CRIP2 is a putative transcription factor. It has a widespread tissue expression and is highly expressed in heart. CRIP2 contains two LIM zinc-binding domains. CRIP2 may participate in the differentiation of smooth muscle tissue. It also plays an important role in esophageal squamous cell carcinoma (ESCC) tumorigenesis. CRIP2 acts as a transcription repressor of the NF-κB-mediated proangiogenic cytokine expression and thus functionally inhibits tumor formation and angiogenesis. It interacts with the NF-κB/p65 to inhibit its DNA-binding ability to the promoter regions of the major proangiogenesis cytokines critical for tumor progression, including IL6, IL8, and VEGF. In conclusion, we provide compelling evidence that CRIP2 acts as a transcription repressor of the NF-κB-mediated proangiogenic cytokine expression and thus functionally inhibits tumor formation and angiogenesis.

References
  • Chang DF. et al., 2003, Dev Cell. 4 (1):107-18.
  • Huber A. et al., 2000, J Biol Chem. 275 (8): 5504-11.
  • Karim MA. et al., 1996, Genomics. 31 (2): 167-76.
  • Size / Price
    Catalog: RG81186-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"