Quick Order

Rat PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PTMAcDNA Clone Product Information
cDNA Size:339
cDNA Description:ORF Clone of Rattus norvegicus prothymosin alpha DNA.
Gene Synonym:Ptma
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

PTMA (prothymosin, alpha, N-GST chimera) is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin a1. Thymosins are named becaues they were originally isolated from the thymus. But now in many other tissues, thymosins also can be detected. Thymosins have diverse biological activities, and two in particular, thymosins a1 and _4, have potentially important uses in medicine, some of which have already progressed from the laboratory to the clinic. In general, PTMA is associated with cellular proliferation and carcinogenesis (Eschenfeldt et al., 1986), cellular and viral transcription (Cotter et al., 2000), protection against apoptosis and chromatin remodelling (Karetsou et al., 1998). PTMA may have a dual role both intracellulary and extracellulary. In relation to diseases, thymosins have been categorized as biological response modifiers. Thymosin a1 is derived from PTMA. For animals that lack thymus glands, thymosin a1 is responsible for the activity of that preparation in restoring immune function.

  • Manrow RE, et al. (1992) The human prothymosin alpha gene family contains several processed pseudogenes lacking deleterious lesions. Genomics. 13(2):319-31.
  • Wara DW, et al. (1975) Thymosin activity in patients with cellular immunodeficiency. N Engl J Med. 292(2):70-4.
  • Garaci E, et al. (2007) Thymosin alpha 1: from bench to bedside. Ann N Y Acad Sci. 1112:225-34.
  • Goldstein AL, et al. (2009) From lab to bedside: emerging clinical applications of thymosin alpha 1. Expert Opin Biol Ther. 9(5):593-608.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items