Quick Order

Text Size:AAA

Rat TSC22D1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat TSC22D1 cDNA Clone Product Information
Gene_bank_ref_id:NM_013043.2
RefSeq ORF Size:432bp
cDNA Description:Full length Clone DNA of Rattus norvegicus TSC22 domain family, member 1 with N terminal His tag.
Gene Synonym:TS22A, TSC-22, Tgfb1i4
Species:Rat
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

TSC22 domain family, member 1 (TSC22D1) is one of the TGF-beta-stimulated clone-22 (TSC-22). TSC-22 was reported to be a differentiation-inducing factor which negatively regulates the growth of salivary gland cancer cells. TSC22D1, which encodes transforming growth factor beta-stimulated clone 22 (TSC-22), is thought to be a tumor suppressor because its expression is lost in many glioblastoma, salivary gland, and prostate cancers. TSC-22 is the founding member of the TSC-22/DIP/Bun family of leucine zipper transcription factors. TSC-22 may play an important role in maintaining the differentiated phenotype in salivary gland tumors, and may be a possible target of leukemia therapy. TSC22D1 forms homodimers via its conserved leucine zipper domain and heterodimerizes with TSC22D4. TSC22D1 has transcriptional repressor activity.

References
  • Doi Y, et al. (2008) Expression and cellular localization of TSC-22 in normal salivary glands and salivary gland tumors: implications for tumor cell differentiation. Oncol Rep. 19(3): 609-16.
  • Wu X, et al. (2008) The Drosophila homolog of human tumor suppressor TSC-22 promotes cellular growth, proliferation, and survival. Proc Natl Acad Sci U S A. 105(14): 5414-9.
  • Lu Y, et al. (2007) Identification of TSC-22 as a potential tumor suppressor that is upregulated by Flt3-D835V but not Flt3-ITD. Leukemia. 21(11): 2246-57.
  • Size / Price
    Catalog: RG81159-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"