Quick Order

Text Size:AAA

Rat PDPN ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat PDPN cDNA Clone Product Information
Gene_bank_ref_id:NM_019358.1
RefSeq ORF Size:501bp
cDNA Description:Full length Clone DNA of Rattus norvegicus podoplanin with N terminal His tag.
Gene Synonym:E11, Gp38, OTS-8, RTI40, T1-alpha
Species:Rat
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Podoplanin, also known as PDPN, is a type-I integral membrane glycoprotein with diverse distribution in human tissues. The physiological function of this protein may be related to its mucin-type character. The homologous protein in other species has been described as a differentiation antigen and influenza-virus receptor. The specific function of this protein has not been determined. Alternatively spliced transcript variants encoding different isoforms have been identified.PDPN is a mucin-type glycoprotein negatively charged by extensive O-glycosylation and a high content of sialic acid, which expresses the adhesive property. It is selectively expressed in lymphatic endothelium as well as lymphangiomas, Kaposi sarcomas, and in a subset of angiosarcomas with probable lymphatic differentiation. PDPN may contribute to form odontoblastic fiber or function as the anchorage to the tooth development and in proliferating epithelial cells of cervical loop and apical bud. The intensity of podoplanin expression is negatively correlated with the expression of CD34 and factor VIII. Podoplanin would be useful as a diagnostic marker for epithelioid hemangioendothelioma in liver tumors.

References
  • Kimura, N. et al., 2005,  Pathol Int. 55 (2): 83-86.
  • Ordóñez, N.G., 2006, Adv Anat Pathol. 13 (2): 83-88.
  • Wicki, A. et al., 2007,  Br. J. Cancer. 96 (1): 1-5.
  • Fujii,T. et al., 2008, Mod Pathol. 21 (2): 125-130.
  • Sawa,Y. et al., 2008, Acta Histochem Cytochem. 41 (5):121-126.
  • Kaddu, S. et al., 2009, Am J Dermatopathol.  31 (2): 137-139.
  • Size / Price
    Catalog: RG81154-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"