Quick Order

Text Size:AAA

Rat ADH5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ADH5cDNA Clone Product Information
cDNA Size:1125
cDNA Description:ORF Clone of Rattus norvegicus alcohol dehydrogenase 5 (class III), chi polypeptide DNA.
Gene Synonym:Adh5
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Carbonic anhydrases IX (CAIX), also known as membrane antigen MN or CA9, is a member of the carbonic anhydrase (CA) family and may be involved in cell proliferation and cellular transformation. CAs are zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide ( H2O + CO2 = H+ + HCO3- ) and thus participate in a variety of biological and physical processes. CAIX is a transmembrane protein structurally consisting of a signal peptide, a proteoglycan-related region, a CA domain with a highly conserved active site, a transmembrane anchor and an intracytoplasmic tail, and is the only tumor-associated CA isoenzyme known so far. Compared with normal tissues, CAIX is overexpressed in a wide spectrum of tumor types and associated with increased metastasis and poor prognosis in aggressive carcinomas. CAIX expression is cell density dependent and has been shown to be strongly induced by hypoxia, accordingly facilitates adaptation of tumor cells to hypoxic conditions. CA9 is regarded as a new therapeutic target for CA9-derived carcinomas.

  • Pastorek, J. et al., 1994, Oncogene. 9: 2877-88.
  • Opavsky, R. et al., 1996, Genomics. 33: 480-7.
  • Swietach, P. et al., 2008, J. Biol. Chem. 283: 20473-83.
  • Robertson, N. et al., 2004, Cancer. Res. 64: 6160-5.
  • Bui, M.H. et al., 2003, Clin. Cancer. Res. 9: 802-11.
  • Choi, S.W. et al., 2008, Hum. Pathol. 39: 1317-22.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items