After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat SPP1 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat SPP1 cDNA Clone Product Information
Gene_bank_ref_id:NM_012881.2
RefSeq ORF Size:954bp
cDNA Description:Full length Clone DNA of Rattus norvegicus secreted phosphoprotein 1 with N terminal HA tag.
Gene Synonym:OSP
Species:Rat
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Osteopontin, also known as Secreted phosphoprotein 1, Bone sialoprotein 1, BSP-1, OPN, and SPP1, is a member of the osteopontin family and a SIBLING glycoprotein. Osteopontin has been classified as T-helper 1 cytokine and thus believed to exacerbate inflammation in several chronic inflammatory diseases, including atherosclerosis. Besides proinflammatory functions, physiologically Osteopontin is a potent inhibitor of mineralization, it prevents ectopic calcium deposits and is a potent inducible inhibitor of vascular calcification. Osteopontin is expressed and secreted by various cells, and has a role in cell adhesion, chemotaxis, prevention of apoptosis, invasion, migration and anchorage-independent growth of tumor cells. Osteopontin recruitment functions of inflammatory cells are thought to be mediated through its adhesive domains, especially the arginine-glycine-aspartate (RGD) sequence that interacts with several integrin heterodimers. Osteopontin has emerged as a potential biomarker and mediator in cardiovascular disease. In the context of atherosclerosis, OPN is generally regarded as a proinflammatory and proatherogenic molecule. However, the role of OPN in vascular calcification (VC), which is closely related to chronic and active inflammation, is that of a negative regulator because it is an inhibitor of calcification and an active inducer of decalcification. Extensive research has demonstrated the pivotal participation of Osteopontin in the regulation of cell signaling which controls neoplastic and malignant transformation. The elevated expression of Osteopontin has been observed in a variety of cancers. It has been linked with tumor metastasis and signifies a poor prognosis for the patient.

References
  • Scatena M, et al. (2007) Osteopontin: a multifunctional molecule regulating chronic inflammation and vascular disease. Arterioscler Thromb Vasc Biol. 27(11): 2302-9.
  • Johnston NI, et al. (2008) Osteopontin as a target for cancer therapy. Front Biosci. 13: 4361-72.
  • Cho HJ, et al. (2009) Osteopontin: a multifunctional protein at the crossroads of inflammation, atherosclerosis, and vascular calcification. Curr Atheroscler Rep. 11(3): 206-13.
  • Waller AH, et al. (2010) Osteopontin in cardiovascular disease: a potential therapeutic target. Cardiol Rev. 18(3): 125-31.
  • Shevde LA, et al. (2010) Osteopontin: an effector and an effect of tumor metastasis. Curr Mol Med. 10(1): 71-81.
  • Size / Price
    Catalog: RG81203-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"