Quick Order

Text Size:AAA

Rat CROT Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CROTcDNA Clone Product Information
cDNA Size:1839
cDNA Description:ORF Clone of Rattus norvegicus carnitine O-octanoyltransferase DNA.
Gene Synonym:Crot
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Carnitine octanoyltransferase (CROT or COT), also known as octanoyl-CoA: L-carnitine O-octanoyltransferase, medium-chain/long-chain carnitine acyltransferase, and carnitine medium-chain acyltransferase, is a carnitine acyltransferase belonging to the family of transferases, specifically those acyltransferases transferring groups other than aminoacyl groups that catalyzes the reversible transfer of fatty acyl groups between CoA and carnitine. Carnitine octanoyltransferase (CROT or COT) facilitate the transport of medium- and long-chain fatty acids through the peroxisomal and mitochondrial membranes. It is physiologically inhibited by malonyl-CoA. COT also has functions in efficiently converting one of the end products of the peroxisomal beta-oxidation of pristanic acid, 4, 8-dimethylnonanoyl-CoA, to its corresponding carnitine ester. 

  • Ferdinandusse S, et al. (1999) Molecular cloning and expression of human carnitine octanoyltransferase: evidence for its role in the peroxisomal beta-oxidation of branched-chain fatty acids. Biochem Biophys Res Commun. 263 (1): 213-8.
  • Feike R, et al. (2000) Genomics of the Human Carnitine Acyltransferase Genes. Molecular Genetics and Metabolism. 71 (1-2): 139-53.
  • Montserrat Morillas, et al. (2002) Structural Model of a Malonyl-CoA-binding Site of Carnitine Octanoyltransferase and Carnitine Palmitoyltransferase I. The Journal of Biological Chemistry, 277: 11473-80.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items