After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat PPARG ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat PPARG cDNA Clone Product Information
Gene_bank_ref_id:NM_001145367.1
RefSeq ORF Size:1428bp
cDNA Description:Full length Clone DNA of Rattus norvegicus peroxisome proliferator-activated receptor gamma with N terminal His tag.
Gene Synonym:Pparg
Species:Rat
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
References
  • Hamblin M, et al. (2009) PPARs and the Cardiovascular System. Antioxid Redox Signal. 11 (6): 1415-52.
  • Khateeb J, et al. (2010) Paraoxonase 1 (PON1) expression in hepatocytes is upregulated by pomegranate polyphenols: a role for PPAR-gamma pathway. Atherosclerosis. 208 (1): 119-25.
  • Fajas L, et al. (1997) The organization, promoter analysis, and expression of the human PPARgamma gene. J Biol Chem. 272 (30): 18779-89.
  • Size / Price
    Catalog: RG80954-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"