Quick Order

Rat SRI ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat SRI cDNA Clone Product Information
Gene_bank_ref_id:NM_001128190.1
RefSeq ORF Size:597bp
cDNA Description:Full length Clone DNA of Rattus norvegicus sorcin with N terminal HA tag.
Gene Synonym:Sri
Species:Rat
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Sorcin was originally identified in multidrug-resistant cells. It is a alcium-binding protein. Sorcin modulates excitation-contraction coupling in the heart, contributes to calcium homeostasis in the heart sarcoplasmic reticulum. Sorcin is overexpressed in the multi-drug resistant chinese hamster ovary cell line CHRC5 and a variety of multidrug-resistant tumor cell lines, but overexpression is not a sufficient or necessary condition for the acquisition of the multidrug-resistant phenotype.

References
  • Meyers MB, et al. (1995) Association of sorcin with the cardiac ryanodine receptor. J Biol Chem. 270(44):26411-8.
  • Brownawell AM, et al. (1997) Calcium-dependent binding of sorcin to the N-terminal domain of synexin (annexin VII). J Biol Chem. 272(35):22182-90.
  • Hansen, et al. (2003) The PEF family proteins sorcin and grancalcin interact in vivo and in vitro. FEBS Lett. 545(2-3):151-4.
  • Size / Price
    Catalog: RG80964-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"