After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat CALML5 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat CALML5 cDNA Clone Product Information
Gene_bank_ref_id:XM_001062982.2
RefSeq ORF Size:444bp
cDNA Description:Full length Clone DNA of Rattus norvegicus calmodulin-like 5 with N terminal His tag.
Gene Synonym:Calm4
Species:Rat
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Calmodulin-like protein 5, also known as Calmodulin-like skin protein, CALML5 and CLSP, is a protein which contains four EF-hand domains. CALML5 / CLSP is particularly abundant in the epidermis where its expression is directly related to keratinocyte differentiation.The expression is very low in lung. CALML5 / CLSP binds calcium. It may be involved in terminal differentiation of keratinocytes. Coxsackievirus and adenovirus receptor (CAR) is a member of the immunoglobulin (Ig) superfamily and a component of epithelial tight junction. CAR functions as a primary receptor for coxsackievirus B and adenovirus (Ad) infection. CALML5 / CLSP is closely related to CAR. The structure and dynamics of human calmodulin-like skin protein CALML5 / CLSP have been characterized by NMR spectroscopy. The mobility of CALML5 / CLSP has been found to be different for the N-terminal and C-terminal domains. The N-terminal domain is characterized by four stable helices, which experience large fluctuations. This is shown to be due to mutations in the hydrophobic core. The overall N-terminal domain behavior is similar both in the full-length protein and in the isolated domain.

References
  • Mehul B., et al., 2000, J. Biol. Chem. 275:12841-12847.
  • Babini E., et al., 2006, Structure 14:1029-1038.
  • Kawabata,K. et al., 2007, Gene Ther. 14 (16):1199-207.
  • Size / Price
    Catalog: RG80799-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"