After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat CD9 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat CD9 cDNA Clone Product Information
Gene_bank_ref_id:NM_053018.1
RefSeq ORF Size:681bp
cDNA Description:Full length Clone DNA of Rattus norvegicus CD9 molecule with N terminal His tag.
Gene Synonym:Cd9
Species:Rat
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD9 is a member of the transmembrane 4 superfamily, which is also known as the tetraspanin family. CD9 is a cell surface glycoprotein with 4 hydrophobic domains that is described to complex with integrins and other transmembrane 4 superfamily members. It is found expressed on the surface of the exosomes. The protein takes part in cellular signal transduction events and thus play a role in the regulation of cell development and activation, growth and motility. Besides, CD9 seems to be a key role in the egg-sperm fusion during the mammalian fertilization processes. CD9 is found on the membrane of the oocytes and also appears to intervene in maintaining the normal shape of oocyte microvilli.

References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12
  • Franois Le Naour, et al. (2000) Severely Reduced Female Fertility in CD9-Deficient Mice. Science. 287(5451): 319-21.
  • Size / Price
    Catalog: RG80778-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"