After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat CALML5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CALML5cDNA Clone Product Information
Gene_bank_ref_id:XM_001062982.2
cDNA Size:444
cDNA Description:ORF Clone of Rattus norvegicus calmodulin-like 5 DNA.
Gene Synonym:Calm4
Species:Rat
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

Calmodulin-like protein 5, also known as Calmodulin-like skin protein, CALML5 and CLSP, is a protein which contains four EF-hand domains. CALML5 / CLSP is particularly abundant in the epidermis where its expression is directly related to keratinocyte differentiation.The expression is very low in lung. CALML5 / CLSP binds calcium. It may be involved in terminal differentiation of keratinocytes. Coxsackievirus and adenovirus receptor (CAR) is a member of the immunoglobulin (Ig) superfamily and a component of epithelial tight junction. CAR functions as a primary receptor for coxsackievirus B and adenovirus (Ad) infection. CALML5 / CLSP is closely related to CAR. The structure and dynamics of human calmodulin-like skin protein CALML5 / CLSP have been characterized by NMR spectroscopy. The mobility of CALML5 / CLSP has been found to be different for the N-terminal and C-terminal domains. The N-terminal domain is characterized by four stable helices, which experience large fluctuations. This is shown to be due to mutations in the hydrophobic core. The overall N-terminal domain behavior is similar both in the full-length protein and in the isolated domain.

References
  • Mehul B., et al., 2000, J. Biol. Chem. 275:12841-12847.
  • Babini E., et al., 2006, Structure 14:1029-1038.
  • Kawabata,K. et al., 2007, Gene Ther. 14 (16):1199-207.
  • Size / Price
    Catalog:RG80799-CY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"