After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat CTHRC1 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat CTHRC1 cDNA Clone Product Information
Gene_bank_ref_id:NM_001271300.1
RefSeq ORF Size:693bp
cDNA Description:Full length Clone DNA of Rattus norvegicus collagen triple helix repeat containing 1 with C terminal HA tag.
Gene Synonym:Cthrc1
Species:Rat
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Collagen triple helix repeat-containing protein 1, also known as Protein NMTC1, and CTHRC1, is a secreted protein that is glycosylated and highly conserved from lower chordates to mammals. CTHRC1 expression was not detectable in normal arteries. However, it is transiently expressed in the arterial wall in response to injury where it may contribute to vascular remodeling by limiting collagen matrix deposition and promoting cell migration. A short collagen motif with 12 Gly-X-Y repeats appears to be responsible for trimerization of the CTHRC1 protein and this renders the molecule susceptible to cleavage by collagenase. CTHRC1 overexpression caused a dramatic reduction in collagen type I mRNA and protein levels. Currently available data indicate that Cthrc1 expression in vascular cells regulates transforming growth factor beta responsiveness, thereby impacting transforming growth factor beta target genes, including collagens. Additionally, CTHRC1 increases bone mass as a positive regulator of osteoblastic bone formation and offers an anabolic approach for the treatment of osteoporosis.

References
  • Pyagay P, et al. (2005) Collagen triple helix repeat containing 1, a novel secreted protein in injured and diseased arteries, inhibits collagen expression and promotes cell migration. Circ Res. 96(2): 261-8.
  • Durmus T, et al. (2006) Expression analysis of the novel gene collagen triple helix repeat containing-1 (Cthrc1). Gene Expr Patterns. 6(8): 935-40.
  • LeClair R, et al. (2007) The role of collagen triple helix repeat containing 1 in injured arteries, collagen expression, and transforming growth factor beta signaling. Trends Cardiovasc Med. 17(6): 202-5.
  • Kimura H, et al. (2008) Cthrc1 is a positive regulator of osteoblastic bone formation. PLoS One. 3(9): e3174.
  • Size / Price
    Catalog: RG80712-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"