After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat CALML5 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat CALML5 cDNA Clone Product Information
Gene_bank_ref_id:XM_001062982.2
RefSeq ORF Size:444bp
cDNA Description:Full length Clone DNA of Rattus norvegicus calmodulin-like 5 with N terminal HA tag.
Gene Synonym:Calm4
Species:Rat
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Calmodulin-like protein 5, also known as Calmodulin-like skin protein, CALML5 and CLSP, is a protein which contains four EF-hand domains. CALML5 / CLSP is particularly abundant in the epidermis where its expression is directly related to keratinocyte differentiation.The expression is very low in lung. CALML5 / CLSP binds calcium. It may be involved in terminal differentiation of keratinocytes. Coxsackievirus and adenovirus receptor (CAR) is a member of the immunoglobulin (Ig) superfamily and a component of epithelial tight junction. CAR functions as a primary receptor for coxsackievirus B and adenovirus (Ad) infection. CALML5 / CLSP is closely related to CAR. The structure and dynamics of human calmodulin-like skin protein CALML5 / CLSP have been characterized by NMR spectroscopy. The mobility of CALML5 / CLSP has been found to be different for the N-terminal and C-terminal domains. The N-terminal domain is characterized by four stable helices, which experience large fluctuations. This is shown to be due to mutations in the hydrophobic core. The overall N-terminal domain behavior is similar both in the full-length protein and in the isolated domain.

References
  • Mehul B., et al., 2000, J. Biol. Chem. 275:12841-12847.
  • Babini E., et al., 2006, Structure 14:1029-1038.
  • Kawabata,K. et al., 2007, Gene Ther. 14 (16):1199-207.
  • Size / Price
    Catalog: RG80799-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"