Quick Order

Rat PGK1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PGK1cDNA Clone Product Information
cDNA Size:1254
cDNA Description:ORF Clone of Rattus norvegicus phosphoglycerate kinase 1 DNA.
Gene Synonym:Pgk
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
  • Rush J. et al., 2005, Nat Biotechnol. 23: 94-101.
  • Olsen JV. et al., 2006, Cell. 127: 635-648.
  • Zieker D. et al., 2008, Cell Physiol Biochem. 21 (5-6): 429-36.
  • Jung Y. et al., 2009, Mol Cancer Res. 7 (10): 1595-604.
  • Choudhary C. et al., 2009, Science. 325: 834-40.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items