Quick Order

Rat ADK Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ADKcDNA Clone Product Information
cDNA Size:1086
cDNA Description:ORF Clone of Rattus norvegicus adenosine kinase DNA.
Gene Synonym:AK
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Adenosine kinase(ADK) belongs to the family of transferases. Adenosine kinase (ADK) is the key enzyme in adenosine metabolism and catalyzes ATP and adenosine into two products: ADP and AMP. Two isoforms of the enzyme adenosine kinase (ADK), which differ at their N-terminal ends, are found in mammalian cells. It has been shown that the two ADK isoforms differ only in their first exons and the promoter regions; hence they arise via differential splicing of their first exons with the other exons common to both isoforms. In adult brain, ADK is primarily present in astrocytes. Several lines of experimental evidence support a critical role of ADK in different types of brain injury associated with astrogliosis, which is also a prominent morphologic feature of temporal lobe epilepsy (TLE). It has been suggested that dysregulation of ADK in astrocytes is a common pathologic hallmark of TLE. Moreover, in vitro data suggest the existence of an additional layer of modulatory crosstalk between the astrocyte-based adenosine cycle and inflammation. ADK also contributes to CK homeostasis in vivo. 

  • Aronica E, et al. (2011) Upregulation of adenosine kinase in astrocytes in experimental and human temporal lobe epilepsy. Epilepsia.52 (9): 1645-55.
  • Kuettel S, et al. (2011) Crystal structures of T. b. rhodesiense adenosine kinase complexed with inhibitor and activator: implications for catalysis and hyperactivation. PLoS Negl Trop Dis. 5 (5): e1164.
  • Cui XA, et al. (2011) Molecular characterization of Chinese hamster cells mutants affected in adenosine kinase and showing novel genetic and biochemical characteristics. BMC Biochem. 12 (1): 22.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items