After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rat VTN Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
VTNcDNA Clone Product Information
cDNA Size:1437
cDNA Description:ORF Clone of Rattus norvegicus vitronectin DNA.
Gene Synonym:Vn, Aa1018
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Vitronectin, also known as VTN, is a member of the pexin family. It is an abundant glycoprotein found in serum the extracellular matrix and promotes cell adhesion and spreading. Vitronectin is a secreted protein and exists in either a single chain form or a cleaved, two chain form held together by a disulfide bond. Vitronectin is a plasma glycoprotein implicated as a regulator of diverse physiological process, including blood coagulation, fibrinolysis, pericellular proteolysis, complement dependent immune responses, and cell attachment and spreading. Because of its ability to bind platelet glycoproteins and mediate platelet adhesion and aggregation at sites of vascular injury, vitronectin has become an important mediator in the pathogenesis of coronary atherosclerosis. As a multifunctional protein with a multiple binding domain, Vitronectin interacts with a variety of plasma and cell proteins. Vitronectin binds multiple ligands, including the soluble vitronectin receptor. It may be an independent predictor of adverse cardiovascular outcomes following acute stenting. Accordingly, Vitronectin is suggested to be involved in hemostasis, cell migration, as well as tumor malignancy.

  • Ekmeki OB, et al. (2006) Vitronectin in atherosclerotic disease. Clin Chim Acta. 368(1-2): 77-83.
  • Derer W, et al. (2009) Vitronectin concentrations predict risk in patients undergoing coronary stenting. Circ Cardiovasc Interv. 2(1): 14-9.
  • Heyman L, et al. (2010) Mesothelial vitronectin stimulates migration of ovarian cancer cells. Cell Biol Int. 34(5): 493-502.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items