Quick Order

Text Size:AAA

Rat PNLIPRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PNLIPRP1cDNA Clone Product Information
Gene_bank_ref_id:NM_032081.1
cDNA Size:1422
cDNA Description:ORF Clone of Rattus norvegicus pancreatic lipase-related protein 1 DNA.
Gene Synonym:Pnliprp1
Species:Rat
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

PNLIPRP1, also known as PLRP1, belongs to the AB hydrolase superfamily, Lipase family. PNLIPRP1 is structurally similar to PLRP2. However, these two proteins display different functional properties. PNLIPRP1 may function as inhibitor of dietary triglyceride digestion. It lacks detectable lipase activity towards triglycerides, diglycerides, phosphatidylcholine, galactolipids or cholesterol esters. PLRP2 hydrolyses milk fat with a lower catalytic efficiency than that of PL. PLRP2 activity, higher on homogenized than on native milk fat, is differently influenced by fatty acids and colipase depending on a proteolytic cleavage in the lid domain.

References
  • Grupe A. et al., 2006, Am J Hum Genet. 78 (1): 78-88.
  • Strausberg RL. et al., 2002, Proc Natl Acad Sci. 99 (26): 16899-903.
  • Giller T. et al., 1992, J Biol Chem. 267 (23): 16509-16.
  • Size / Price
    Catalog:RG80624-CY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"