After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rat F2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
F2cDNA Clone Product Information
Gene Bank Ref.ID:NM_022924.2
cDNA Size:1854
cDNA Description:ORF Clone of Rattus norvegicus coagulation factor II DNA.
Gene Synonym:F2
Restriction Site:
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Coagulation Factor II Protein (FII, F2 Protein or Prothrombin) is proteolytically cleaved to form thrombin in the first step of the coagulation cascade which ultimately results in the stemming of blood loss. Coagulation Factor II Protein (FII, F2 Protein) also plays a role in maintaining vascular integrity during development and postnatal life. Prothrombin / Coagulation Factor II is activated on the surface of a phospholipid membrane that binds the amino end of prothrombin / Coagulation Factor II and factor Va and Xa in Ca-dependent interactions; factor Xa removes the activation peptide and cleaves the remaining part into light and heavy chains. The activation process starts slowly because factor V itself has to be activated by the initial, small amounts of thrombin. Prothrombin / Coagulation Factor II is expressed by the liver and secreted in plasma. Defects in prothrombin / Coagulation Factor II are the cause of factor II deficiency (FA2D). It is very rare blood coagulation disorder characterized by mucocutaneous bleeding symptoms. The severity of the bleeding manifestations correlates with blood factor II levels. Defects in Coagulation Factor II are also a cause of susceptibility to thrombosis. It is a multifactorial disorder of hemostasis characterized by abnormal platelet aggregation in response to various agents and recurrent thrombi formation.

  • Danneberg J, et al. (1998) Reliable genotyping of the G-20210-A mutation of Coagulation Factor II (prothrombin). Clin Chem. 44(2): 349-51.
  • Redondo M, et al. (1999) Coagulation Factor s II, V, VII, and X, prothrombin gene 20210GA transition, and factor V Leiden in coronary artery disease: high factor V clotting activity is an independent risk factor for myocardial infarction. Arterioscler Thromb Vasc Biol. 19(4): 1020-5.
  • Miletich JP, et al. (1980) The synthesis of sulfated dextran beads for isolation of human plasma Coagulation Factor s II, IX, and X. Anal Biochem. 105(2): 304-10.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availsability:2-3 weeks