Quick Order

Rat CCL6 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat CCL6 cDNA Clone Product Information
Gene_bank_ref_id:BC079460.1
RefSeq ORF Size:348bp
cDNA Description:Full length Clone DNA of Rattus norvegicus chemokine (C-C motif) ligand 6 with N terminal HA tag.
Gene Synonym:Mrp-1, Scay6
Species:Rat
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Background

Chemokine (C-C motif) ligand 6 (CCL6), also known as C-C chemokine C10 has only been identified in rodents, which is a small cytokine belonging to the CC chemokine family, beta-chemokine subfamily. C-C chemokine C10 is involved in the chronic stages of host defense reactions. C10 chemokine rapidly promotes disease resolution in the cecal ligation and puncture (CLP) model through its direct effects on the cellular events critically involved in host defense during septic peritonitis. CCL6 appears to contribute to the macrophage infiltration that is independent of other CC chemokines. C10 is a prominent chemokine expressed in the central nervous system in experimental inflammatory demyelinating disease, also acts as a potent chemotactic factor for the migration of these leukocytes to the brain. CCL6 may be a mediator released by microglia for cell-cell communication under physiological as well as pathological conditions of CNS. Additionally, the chemokine CCL6 may alter tumor behavior by relieving its growth factor dependency and by promoting invasiveness as a result of local tissue apoptosis.

References
  • Asensio VC, et al. (1999) C10 is a novel chemokine expressed in experimental inflammatory demyelinating disorders that promotes recruitment of macrophages to the central nervous system. Am J Pathol. 154(4): 1181-91.
  • Steinhauser ML, et al. (2000) Chemokine C10 promotes disease resolution and survival in an experimental model of bacterial sepsis. Infect Immun. 68(11): 6108-14.
  • Yi F, et al. (2003) The CCL6 chemokine is differentially regulated by c-Myc and L-Myc, and promotes tumorigenesis and metastasis. Cancer Res. 63(11): 2923-32.
  • LaFleur AM, et al. (2004) Role of CC chemokine CCL6/C10 as a monocyte chemoattractant in a murine acute peritonitis. Mediators Inflamm. 13(5-6): 349-55.
  • Kanno M, et al. (2005) Functional expression of CCL6 by rat microglia: a possible role of CCL6 in cell-cell communication. J Neuroimmunol. 167(1-2): 72-80.
  •  

    CCL6/C10 related areas, pathways, and other information

    Size / Price
    Catalog: RG80721-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"