Quick Order

Rat KLK13 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
KLK13cDNA Clone Product Information
Gene_bank_ref_id:NM_001170405.1
cDNA Size:831
cDNA Description:ORF Clone of Rattus norvegicus kallikrein related-peptidase 13 DNA.
Gene Synonym:Klk13
Species:Rat
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

Human tissue kallikrein 13 (hK13), also known as KLK-L4 (kallikrein-like gene 4), is a member of the human tissue kallikrein family of serine proteases having diverse physiological functions in many tissues. The KLK13 gene resides on chromosome 19q13.3-4 along with other 14 members in a gene cluster and shares a high degree of homology. KLK13 is a trypsin-like, secreted serine protease expressed specifically in the testicular tissue including prostate, salivary gland, breast, and testis. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and may play a role in metastasis. KLK13 may be involved in the pathogenesis and/or progression of breast and ovary cancers, and is regarded as a novel cancer biomarker. In addition, KLK13 interacts and forms complexes with several serum protease inhibitors, such as alpha2-macroglobulin, and its expression is regulated by steroid hormones.

Size / Price
Catalog:RG80544-CY
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"