Quick Order

Rat SERPINA1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat SERPINA1 cDNA Clone Product Information
Gene_bank_ref_id:NM_022519.2
RefSeq ORF Size:1236bp
cDNA Description:Full length Clone DNA of Rattus norvegicus serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1 with N terminal His tag.
Gene Synonym:Pi; AAT; Spi1
Species:Rat
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

SerpinA1, also known as Alpha-1 antitrypsin (AAT), is a prototype member of the Serpin superfamily of the serine protease inhibitors. This serine protease inhibitor blocks the protease, neutrophil elastase. Alpha-1 antitrypsin is mainly produced in the liver and acts as an antiprotease. Its principal function is to inactivate neutrophil elastase, preventing tissue damage. SerpinA1 (alpha1-antitrypsin), an acute phase protein and the classical neutrophil elastase inhibitor, is localized within lipid rafts in primary human monocytes in vitro. It association with monocytes is inhibited by cholesterol depleting/efflux-stimulating agents (nystatin, filipin, MbetaCD (methyl-beta-cyclodextrin) and oxidized low-density lipoprotein (oxLDL) and conversely, enhanced by free cholesterol. Furthermore, SerpinA1/monocyte association per se depletes lipid raft cholesterol as characterized by the activation of extracellular signal-regulated kinase 2, formation of cytosolic lipid droplets, and a complete inhibition of oxLDL uptake by monocytes. Previous population studies have suggested that heterozygote status for the AAT gene (SerpinA1) is a risk factor for chronic rhinosinusitis with nasal polyposis (CRSwNP). Alpha-1 antitrypsin deficiency is a recently identified genetic disease that occurs almost as frequently as cystic fibrosis. It is caused by various mutations in the SerpinA1 gene, and has numerous clinical implications. Alpha-1 antitrypsin deficiency is an inherited disease affecting the lung and liver. In the liver, alpha-1 antitrypsin deficiency may manifest as benign neonatal hepatitis syndrome; a small percentage of adults develop liver fibrosis, with progression to cirrhosis and hepatocellular carcinoma. Its most important physiologic functions are the protection of pulmonary tissue from aggressive proteolytic enzymes and regulation of pulmonary immune processes.

References
  • Khnlein T, et al. (2008) Alpha-1 antitrypsin deficiency: pathogenesis, clinical presentation, diagnosis, and treatment. Am J Med. 121(1): 3-9.
  • Camelier AA, et al. (2008) Alpha-1 antitrypsin deficiency: diagnosis and treatment. J Bras Pneumol. 34(7): 514-27.
  • Subramaniyam D, et al. (2010) Cholesterol rich lipid raft microdomains are gateway for acute phase protein, SERPINA1. Int J Biochem Cell Biol. 42(9): 1562-70.
  • Kilty SJ, et al. (2010) Polymorphisms in the SERPINA1 (Alpha-1-Antitrypsin) gene are associated with severe chronic rhinosinusitis unresponsive to medical therapy. Am J Rhinol Allergy. 24(1): e4-9.
  • Size / Price
    Catalog: RG80476-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"