Quick Order

Text Size:AAA

Rat AHSG Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
AHSGcDNA Clone Product Information
Gene_bank_ref_id:BC091118.1
cDNA Size:1059
cDNA Description:ORF Clone of Rattus norvegicus alpha-2-HS-glycoprotein DNA.
Gene Synonym:pp63, Aa2-066
Species:Rat
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

Fetuin-A, also known as Alpha-2-HS-Glycoprotein (AHSG), belongs to the Fetuin family, is a plasma binding protein, and is more abundant in fetal than adult blood. It is involved in several functions, such as endocytosis, brain development and the formation of bone tissue. Fetuins are carrier proteins like albumin. Fetuin-A forms soluble complexes with calcium and phosphate and thus is a carrier of otherwise insoluble calcium phosphate. Thus Fetuin-A is a potent inhibitor of pathological calcification. The circulating levels of fetuin-A, a well-described inhibitor of calcification, regulate the cell-dependent process of osteogenesis. The low circulating fetuin-A levels are associated with a greater prevalence and/or severity of Vascular calcification (VC) and increased risk for all-cause and cardiovascular mortality. However, high circulating fetuin-A levels appear to induce insulin resistance and, in non-dialyzed subjects with diabetic nephropathy, are directly related to VC burden. The emerging role of fetuin-A deficiency as a risk factor in dialysis patients was documented in cross-sectional studies demonstrating a significant correlation with all-cause and cardiovascular mortality. Additionally, Human fetuin-A is a negative acute phase protein involved in inflammatory diseases, thus being a potential physiological regulator of meprin activity. Fetuin-A is a broad-range protease inhibitor. Fetuin-A and cystatin C as endogenous proteolytic regulators of meprin activity broadens our understanding of the proteolytic network in plasma.

References
  • Mehrotra R. (2007) Emerging role for fetuin-A as contributor to morbidity and mortality in chronic kidney disease. Kidney Int. 72(2): 137-40.
  • Westenfeld R, et al. (2007) Vascular calcification and fetuin-A deficiency in chronic kidney disease. Trends Cardiovasc Med. 17(4): 124-8.
  • Heiss A, et al. (2008). Hierarchical role of fetuin-A and acidic serum proteins in the formation and stabilization of calcium phosphate particles. J Biol Chem. 283 (21): 14815-25.
  • Jahnen-Dechent W, et al. (2008). Mineral chaperones: a role for fetuin-A and osteopontin in the inhibition and regression of pathologic calcification. J Mol Med. 86 (4): 379-89.
  • Hedrich J, et al. (2010) Fetuin-A and cystatin C are endogenous inhibitors of human meprin metalloproteases. Biochemistry. 49(39): 8599-607.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"