After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat IL22RA1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL22RA1cDNA Clone Product Information
cDNA Size:1734
cDNA Description:ORF Clone of Rattus norvegicus interleukin22receptor,alpha1 DNA.
Gene Synonym:RGD1559655, Il22ra1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

IL-10 Family & Receptor Related Products

IL-22R belongs to the type II cytokine receptor family. It contains 2 fibronectin type-III domains and is expressed in colon, liver, lung, pancreas and kidney. IL-22R also can be expressed in keratinocytes of normal skin as well as in psoriatic skin lesion. Overexpression of IL-22R can be detected in synovial fluid cells from rheumatoid arthritis and spondyloarthropathy patients. IL-22R is a component of the receptor for IL20, IL22 and IL24. The component of IL-22R formed by IL22RA1 and IL10RB enables IL22 signaling via JAK/STAT pathways. IL22 also induces activation of MAPK1/MAPK3 and Akt kinases pathways. Component of one of the receptor for IL20 and IL24 formed by IL22RA1 and IL20RB also signaling through STATs activation. IL-22R mediates IL24 antiangiogenic activity as well as IL24 inhibitory effect on endothelial cell tube formation and differentiation.

  • Xie MH, et al. (2000) Interleukin (IL)-22, a novel human cytokine that signals through the interferon receptor-related proteins CRF2-4 and IL-22R. J Biol Chem. 275(40):31335-9.
  • Xu W, et al. (2001) A soluble class II cytokine receptor, IL-22RA2, is a naturally occurring IL-22 antagonist. Proc Natl Acad Sci. 98(17):9511-6.
  • Wu PW, et al. (2008) IL-22R, IL-10R2, and IL-22BP binding sites are topologically juxtaposed on adjacent and overlapping surfaces of IL-22. J Mol Biol. 382(5):1168-83.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items