Quick Order

Rat AHSG Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
AHSGcDNA Clone Product Information
cDNA Size:1059
cDNA Description:ORF Clone of Rattus norvegicus alpha-2-HS-glycoprotein DNA.
Gene Synonym:pp63, Aa2-066
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Fetuin-A, also known as Alpha-2-HS-Glycoprotein (AHSG), belongs to the Fetuin family, is a plasma binding protein, and is more abundant in fetal than adult blood. It is involved in several functions, such as endocytosis, brain development and the formation of bone tissue. Fetuins are carrier proteins like albumin. Fetuin-A forms soluble complexes with calcium and phosphate and thus is a carrier of otherwise insoluble calcium phosphate. Thus Fetuin-A is a potent inhibitor of pathological calcification. The circulating levels of fetuin-A, a well-described inhibitor of calcification, regulate the cell-dependent process of osteogenesis. The low circulating fetuin-A levels are associated with a greater prevalence and/or severity of Vascular calcification (VC) and increased risk for all-cause and cardiovascular mortality. However, high circulating fetuin-A levels appear to induce insulin resistance and, in non-dialyzed subjects with diabetic nephropathy, are directly related to VC burden. The emerging role of fetuin-A deficiency as a risk factor in dialysis patients was documented in cross-sectional studies demonstrating a significant correlation with all-cause and cardiovascular mortality. Additionally, Human fetuin-A is a negative acute phase protein involved in inflammatory diseases, thus being a potential physiological regulator of meprin activity. Fetuin-A is a broad-range protease inhibitor. Fetuin-A and cystatin C as endogenous proteolytic regulators of meprin activity broadens our understanding of the proteolytic network in plasma.

  • Mehrotra R. (2007) Emerging role for fetuin-A as contributor to morbidity and mortality in chronic kidney disease. Kidney Int. 72(2): 137-40.
  • Westenfeld R, et al. (2007) Vascular calcification and fetuin-A deficiency in chronic kidney disease. Trends Cardiovasc Med. 17(4): 124-8.
  • Heiss A, et al. (2008). Hierarchical role of fetuin-A and acidic serum proteins in the formation and stabilization of calcium phosphate particles. J Biol Chem. 283 (21): 14815-25.
  • Jahnen-Dechent W, et al. (2008). Mineral chaperones: a role for fetuin-A and osteopontin in the inhibition and regression of pathologic calcification. J Mol Med. 86 (4): 379-89.
  • Hedrich J, et al. (2010) Fetuin-A and cystatin C are endogenous inhibitors of human meprin metalloproteases. Biochemistry. 49(39): 8599-607.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items