After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rat NINJ1 / Ninjurin1 ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Rat NINJ1 cDNA Clone Product Information
NCBI RefSeq:NM_012867.1
RefSeq ORF Size:459bp
cDNA Description:Full length Clone DNA of Rattus norvegicus ninjurin 1 with N terminal His tag.
Gene Synonym:Ninj1
Species:Rat
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Ninjurin-1, also known as NINJ1, is a member of the Ninjurin family of transmembrane (TM) proteins. It is expressed in CD19(+) CD10(+) B-cell progenitor cells and higher levels in B-lineage acute lymphoblastic leukemia cells. Ninjurin-1 is expressed also in a number of other adult and embryonic tissues, predominantly in epithelial cells. Its expression is upregulated after axotomy in neurons and in Schwann cells surrounding the distal nerve segment. Upregulated expression of ninjurin-1 has been identified as a marker of minimal residual disease in B-lineage acute lymphoblastic leukemia. It mediates homophilic adhesion, and promotes neurite extension of dorsal root ganglion neurons in vitro. Ninjurin-1 has been found to show a high expression level in the liver tissue of patients with hepatocellular carcinoma, and this seems to be associated with cases of cirrhosis and chronic viral hepatitis. It has been reported that NINJURIN increases p21 expression and induces cellular senescence in human hepatoma cells.

References
  • Cardoso CC, et al. (2007) Ninjurin 1 asp110ala single nucleotide polymorphism is associated with protection in leprosy nerve damage. J Neuroimmunol. 190 (1-2): 131-8.
  • Ifergan I, et al. (2011) Role of Ninjurin-1 in the migration of myeloid cells to central nervous system inflammatory lesions. Ann Neurol. 70 (5): 751-63.
  • Toyama T, et al. (2005) Ninjurin1 increases p21 expression and induces cellular senescence in human hepatoma cells. J Hepatol. 41 (4): 637-43.
  • Size / Price
    Catalog: RG80424-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"