Quick Order

Rat IL17F ORF mammalian expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Rat IL17F cDNA Clone Product Information
NCBI RefSeq:NM_001015011.1
RefSeq ORF Size:462bp
cDNA Description:Full length Clone DNA of Rattus norvegicus interleukin 17F with C terminal HA tag.
Gene Synonym:IL17F
Species:Rat
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Rhesus IL17BR / IL17RB / IL-17 Receptor B Protein (Fc Tag)Canine IL-17RD Protein (Fc Tag)Rhesus IL17 / IL17a ProteinRhesus IL17BR / IL17RB / IL-17 Receptor B Protein (ECD, His Tag)Human IL17B / IL-17B Protein (Fc Tag)Rat IL17F / IL-17F Protein (His Tag)Canine IL17RD Protein (His Tag)Human IL25 Protein (Fc Tag)Human IL17RD Protein (His Tag)Mouse IL25 Protein (His Tag)Human p38 alpha / MAPK14 Protein (His Tag)Human IL17RA / CD217 Protein (His & Fc Tag)Human ERK2 / MAPK1 / MAPK2 Protein (GST Tag)Human IL17RA / CD217 Protein (His Tag)Human IKB alpha / NFKBIA Protein (His Tag)Mouse IL17RA / IL17R / CD217 Protein (His Tag)Human IL-17F / Interleukin-17F Protein (His Tag)Mouse IL17F / IL-17F Protein (His Tag)Mouse IL17F / IL-17F ProteinHuman p38 delta / MAPK13 Protein (GST Tag)Human IL17RB / IL-17 Receptor B Protein (Flag Tag)Mouse IL17B / IL-17B Protein (Fc Tag)Human RELA / Transcription factor p65 / NFkB p65 Protein (aa 1-306, GST Tag)Human IL17RC Protein (aa 1-454, His Tag)Human IL17RC Protein (Fc Tag)Mouse ERK2 / MAPK1 / MAPK2 Protein (His & GST Tag)Human p38 delta / MAPK13 Protein (Activated in vitro, GST Tag)Human IL17 / IL17A Protein (His Tag)Human IL17 / IL17A ProteinMouse IL17 / IL17A ProteinRat IL17RA / IL17R Protein (His Tag)Human p38 alpha / MAPK14 Protein (His Tag)Rat Interleukin 25 / IL25 / IL17E Protein (Fc Tag)Rhesus IL17RA / IL17R Protein (Fc Tag)Mouse ERK2 / MAPK1 / MAPK2 ProteinMouse IL17BR / IL17RB / IL-17 Receptor B Protein (His Tag)Mouse IL17RA / IL17R / CD217 Protein (Fc Tag)Human IL17 / IL17A Protein (His Tag)Human IL-17F / IL17F ProteinHuman IL17BR / IL17RB / IL-17 Receptor B Protein (Fc Tag)Canine IL17 / IL17A ProteinRat IL17RA / IL17R Protein (Fc Tag)Marmoset IL17 / IL17A ProteinHuman IL17BR / IL17RB / IL-17 Receptor B Protein (His Tag)Human IL17 / IL17A ProteinMouse IL17BR / IL17RB / IL-17 Receptor B Protein (Fc Tag)
Background

Interleukin-17F (IL-17F) is a cytokine that shares sequence similarity with IL17. The most notable role of IL-17 is it involvement in inducing and mediating proinflammatory responses. IL-17 is commonly associated with allergic responses. IL-17F is expressed by activated T cells, and was expressed only in activated CD4+ T cells and activated monocytes. IL-17F has been shown to stimulate the production of several other cytokines, including IL6 and IL8. This cytokine is also found to inhibit the angiogenesis of endothelial cells and induce endothelial cells to produce IL2, TGFB1/TGFB, and monocyte chemoattractant protein-1. Recombinant human IL-17F did not stimulate the proliferation of hematopoietic progenitors or the migration of mature leukocytes. However, it markedly inhibited the angiogenesis of human endothelial cells and induced endothelial cells to produce IL-2, TGF-{beta}, and monocyte chemoattractant protein-1. IL-17F stimulates the production of other cytokines and granulocyte colony-stimulating factor, and can regulate cartilage matrix turnover. IL-17F stimulates PBMC and T-cell proliferation. It also function in inhibiting angiogenesis By similarity. IL-17F plays a role in the induction of neutrophilia in the lungs and in the exacerbation of antigen-induced pulmonary allergic inflammation.

References
et al..
  • Starnes T, et al.. (2001) Cutting edge: IL-17F, a novel cytokine selectively expressed in activated T cells and monocytes, regulates angiogenesis and endothelial cell cytokine production. J Immunol. 167(8): 4137-40.
  • Hymowitz SG, et al.. (2001) IL-17s adopt a cystine knot fold: structure and activity of a novel cytokine, IL-17F, and implications for receptor binding. EMBO J. 20(19): 5332-41.
  • McAllister F, et al.. (2005) Role of IL-17A, IL-17F, and the IL-17 receptor in regulating growth-related oncogene-alpha and granulocyte colony-stimulating factor in bronchial epithelium: implications for airway inflammation in cystic fibrosis. J Immunol. 175(1): 404-12.
  • Size / Price
    Catalog: RG80462-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"