Quick Order

Text Size:AAA

Rat MFI2 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat MFI2 cDNA Clone Product Information
Gene_bank_ref_id:NM_001105872.1
RefSeq ORF Size:2217bp
cDNA Description:Full length Clone DNA of Rattus norvegicus antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 with N terminal His tag.
Gene Synonym:Mfi2
Species:Rat
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
References
  • Richardson DR. (2000) The role of the membrane-bound tumour antigen, melanotransferrin (p97), in iron uptake by the human malignant melanoma cell. Eur J Biochem. 267(5): 1290-8.
  • Kim DK, et al. (2001) Serum melanotransferrin, p97 as a biochemical marker of Alzheimer's disease. Neuropsychopharmacology. 25(1): 84-90.
  • Rothenberger S, et al. (1996) Coincident expression and distribution of melanotransferrin and transferrin receptor in human brain capillary endothelium. Brain Res. 712(1): 117-21.
  • Baker EN, et al. (1992) Human melanotransferrin (p97) has only one functional iron-binding site. FEBS Lett. 298(2-3): 215-8.
  • Size / Price
    Catalog: RG80403-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"