Quick Order

Text Size:AAA

Rat RHOA ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat RHOA cDNA Clone Product Information
NCBI RefSeq:BC061732.1
RefSeq ORF Size:582bp
cDNA Description:Full length Clone DNA of Rattus norvegicus ras homolog family member A with N terminal HA tag.
Gene Synonym:Arha, Arha2
Species:Rat
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Transforming protein RhoA, also known as Rho cDNA clone 12, Ras homolog gene family member A, RHOA and ARH12, is a cell membrane and cytoplasm protein which belongs to the small GTPase superfamily and Rho family. The Rho family of small GTPases plays a key role in the dynamic regulation of the actin cytoskeleton that underlies various important cellular functions such as shape changes, migration, and polarity. RHOA / ARH12 is part of a larger family of related proteins known as the Ras superfamily; proteins involved in the regulation and timing of cell division. RHOA / ARH12 is a small GTPase protein known to regulate the actin cytoskeleton in the formation of stress fibers. It acts upon two known effector proteins: ROCK1 (Rho-associated, coiled-coil containing protein kinase 1) and DIAPH1 ( diaphanous homolog 1 (Drosophila) ). RHOA / ARH12 regulates a signal transduction pathway linking plasma membrane receptors to the assembly of focal adhesions and actin stress fibers. RHOA / ARH12 serves as a target for the yopT cysteine peptidase from Yersinia pestis, vector of the plague, and Yersinia pseudotuberculosis, which causes gastrointestinal disorders. RHOA / ARH12 may be an activator of PLCE1. It is activated by ARHGEF2, which promotes the exchange of GDP for GTP.

References
  • Kiss C, et al.,1997, Cytogenet. Cell Genet. 79 (3-4): 228-30.
  • Anastasiadis,P.Z. et al., 2000, Nat Cell Biol. 2 (9):637-44.
  • Yiu G, et al.,2006, Nat. Rev. Neurosci. 7 (8): 617-27.
  • Wang,HR. et al., 2006, Methods Enzymol. 406 :437-47.
  • Heo,J. et al., 2006, Biochemistry. 45 (48):14481-9.
  • Size / Price
    Catalog: RG80547-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"