After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat CD247 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD247cDNA Clone Product Information
cDNA Size:495
cDNA Description:ORF Clone of Rattus norvegicus Cd247 molecule DNA.
Gene Synonym:Cd3z, TCRzeta, Cd247
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

CD247, also known as CD3-ZETA, belongs to the CD3Z/FCER1G family. It contains 3 ITAM domains. As a -cell receptor zeta, CD247 forms the T-cell receptor-CD3 complex together with T-cell receptor alpha/beta and gamma/delta heterodimers, and with CD3-gamma, -delta and –epsilon. The zeta chain plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. Low expression of the antigen results in impaired immune response. Two alternatively spliced transcript variants encoding distinct isoforms have been found for CD247 gene. Defects in CD247 can cause immunodeficiency due to defect in CD3-zeta. An immunological deficiency characterized by T-cells impaired immune response to alloantigens, tetanus toxoid and mitogens. CD247 may play a role in assembly and expression of the TCR complex as well as signal transduction upon antigen triggering.

  • 1. Radstake TR, et al. (2010) Genome-wide association study of systemic sclerosis identifies CD247 as a new susceptibility locus. Nat Genet. 42(5):426-9.
  • 2. Dieud P, et al. (2011) Independent replication establishes the CD247 gene as a genetic systemic sclerosis susceptibility factor. Ann Rheum Dis. 70(9):1695-6.
  • 3. Li R, et al. (2012) Association of CD247 with systemic lupus erythematosus in Asian populations. Lupus. 21(1):75-83.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items