After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat LAIR1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LAIR1cDNA Clone Product Information
cDNA Size:792
cDNA Description:ORF Clone of Rattus norvegicus leukocyte-associated immunoglobulin-like receptor 1 DNA.
Gene Synonym:Lair1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Leukocyte associated Ig-like receptor-1 (LAIR1) is a surface molecule expressed on human mononuclear leukocytes that functions as an inhibitory receptor on human NK cells. In addition to NK cells, LAIR1 is expressed on T cells, B cells, macrophages, and dendritic cells. It is predicted to mediate inhibitory functions based on the presence of immunoreceptor tyrosine-based inhibitory motifs (ITIMs) in its cytoplasmic domain. Cross-linking of LAIR1 on human T cell clones results in inhibition of cytotoxicity only in T cell clones that lack CD28 and are able to spontaneously lyse certain targets in vitro. Moreover, the cytolytic activity of freshly isolated T cells, which is thought to be mainly due to "effector" T cells, can be inhibited by anti-LAIR1 mAb. Thus, LAIR1 functions as an inhibitory receptor not only on NK cells, but also on human T cells. This indicates that LAIR1 provides a mechanism of regulation of effector T cells and may play a role in the inhibition of unwanted bystander responses mediated by Ag-specific T cells. 

  • Meyaard L, et al. (1999) Leukocyte-associated Ig-like receptor-1 functions as an inhibitory receptor on cytotoxic T cells. J Immunol. 162 (10): 5800-4.
  • Meyaard L, et al. (2001) The epithelial cellular adhesion molecule (Ep-CAM) is a ligand for the leukocyte-associated immunoglobulin-like receptor (LAIR). J Exp Med. 194 (1): 107-12.
  • Xu M, et al. (2000) Identification and characterization of leukocyte-associated Ig-like receptor-1 as a major anchor protein of tyrosine phosphatase SHP-1 in hematopoietic cells. J Biol Chem. 275 (23): 17440-6.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items