Quick Order

Rat CD300LG ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat CD300LG cDNA Clone Product Information
Gene_bank_ref_id:XM_002727812.1
RefSeq ORF Size:849bp
cDNA Description:Full length Clone DNA of Rattus norvegicus Cd300 molecule-like family member G with C terminal HA tag.
Gene Synonym:RGD1311074, Cd300lg
Species:Rat
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

CLM-9, also known as TREM4, is a receptor which belongs to the TREM family. The TREM family of receptors regulates the activity of various cell types of the immune system including neutrophils, monocyte/macrophages, microglia, and dendritic cells. CLM-9 may mediate L-selectin-dependent lymphocyte rollings. It binds SELL in a calcium dependent manner. CLM-9 also binds lymphocyte which suggests that it functions in lymphocyte adhesion. The major CLM-9 transcript is expressed highly in human heart, skeletal muscle, and placenta. The mouse protein has been shown to be expressed in capillary endothelial cells. Human CLM-9 mediates the uptake of human IgA2 and mouse IgM.

References
  • Clark GJ, et al. (2009) The CD300 molecules regulate monocyte and dendritic cell functions. Immunobiology. 214(9-10):730-6.
  • Engel K, et al. (2012) Bacterial expression of mutant argininosuccinate lyase reveals imperfect correlation of in-vitro enzyme activity with clinical phenotype in argininosuccinic aciduria. J Inherit Metab Dis. 35(1):133-40.
  • Lamesch P, et al. (2007) hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. Genomics. 89(3):307-15.
  • Size / Price
    Catalog: RG80413-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"