Quick Order

Text Size:AAA

Rat JAM2 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat JAM2 cDNA Clone Product Information
Gene_bank_ref_id:NM_001034004.1
RefSeq ORF Size:897bp
cDNA Description:Full length Clone DNA of Rattus norvegicus junctional adhesion molecule 2 with N terminal His tag.
Gene Synonym:Jam2
Species:Rat
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Junctional adhesion molecule B (JAM-B), also known as Junctional adhesion molecule 2 (JAM2), Vascular endothelial junction-associated molecule (VE-JAM), and CD322, is a single-pass type I membrane protein which belongs to the immunoglobulin superfamily. It is prominently expressed on high endothelial venules. expression to be restricted to the high endothelial venule of tonsil and lymph nodes. The localization to the endothelium of arterioles in and around inflammatory and tumor foci. JAM-B can function as an adhesive ligand for the T cell line J45 and can interact with GM-CSF/IL-4-derived peripheral blood dendritic cells, circulating CD56(+) NK cells, circulating CD56(+)CD3(+) NK/T cells, and circulating CD56(+)CD3(+)CD8(+) cytolytic T cells. JAM-2 is expressed on high endothelial venules (HEVs) in human tonsil and on a subset of human leukocytes, suggesting that JAM-2 plays a central role in the regulation of transendothelial migration. It binds to very late activation antigen (VLA)-4, a leucocyte integrin that contributes to rolling and firm adhesion of lymphocytes to endothelial cells through binding to vascular cell adhesion molecule (VCAM)-1. JAM-B appears to contribute to leucocyte extravasation by facilitating not only transmigration but also rolling and adhesion. JAM-B acts as an adhesive ligand for interacting with a variety of immune cell types and may play a role in lymphocyte homing to secondary lymphoid organs.

References
  • Johnson-Lger CA, et al. (2002) Junctional adhesion molecule-2 (JAM-2) promotes lymphocyte transendothelial migration. Blood. 2100(7): 2479-86.
  • Liang TW, et al. (2002) Vascular endothelial-junctional adhesion molecule (VE-JAM)/JAM 2 interacts with T, NK, and dendritic cells through JAM 3. J Immunol. 168(4): 1618-26.
  • Ludwig RJ, et al. (2009) Junctional adhesion molecule (JAM)-B supports lymphocyte rolling and adhesion through interaction with alpha4beta1 integrin. Immunology. 128(2): 196-205.
  • Size / Price
    Catalog: RG80376-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"