Quick Order

Rat CD5 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat CD5 cDNA Clone Product Information
Gene_bank_ref_id:NM_019295.1
RefSeq ORF Size:1476bp
cDNA Description:Full length Clone DNA of Rattus norvegicus Cd5 molecule with N terminal His tag.
Gene Synonym:MGC114334, Cd5
Species:Rat
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD5 is a member of the CD system. CD5 was found to be widely distributed in T-cells and B1 cells which is a subset of IgM-secreting B cells. CD5 also was found expressed in small lymphocytic lymphoma, hairy cell leukaemia and mantle cell lymphoma cells. CD5 serves to weaken the activating stimulus from the BCR so that the B1 cells can only reflect to the very strong stimuli but not the normal tissue proteins.

References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters. 134 (2): 104-12.
  • Kirchgessner H, et al. (2001) The transmembrane adaptor protein TRIM regulates T cell receptor (TCR) expression and TCR-mediated signaling via an association with the TCR zeta chain. J Exp Med. 193 (11): 1269-84.
  • Size / Price
    Catalog: RG80374-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"